View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12313_low_14 (Length: 208)
Name: NF12313_low_14
Description: NF12313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12313_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 4 - 193
Target Start/End: Complemental strand, 34141083 - 34140880
Alignment:
| Q |
4 |
agacaattataagatgctactttttacttggtctctatttttgtgtttctgaaatattaacattaacaatattttttacaaggta--------------g |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
34141083 |
agacaattataagatgctactttttacttggtctctatttttgtgtttctgaaatattaacattaacaatattttttacaaggtattttatacaaggtag |
34140984 |
T |
 |
| Q |
90 |
taattataattttaggtgatacaatctttgaattgtttatagagatcaaatgagctgccattataagcctataatataactggtaacaacttggaggggc |
189 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34140983 |
taattatatttgtaggtgatacaatctttgaattgtttttagagatcaaatgagctgccattataagcctataatataactggtaacaacttggaggggc |
34140884 |
T |
 |
| Q |
190 |
acag |
193 |
Q |
| |
|
|||| |
|
|
| T |
34140883 |
acag |
34140880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University