View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12314_low_10 (Length: 209)
Name: NF12314_low_10
Description: NF12314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12314_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 3e-87; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 19 - 197
Target Start/End: Original strand, 20037124 - 20037302
Alignment:
| Q |
19 |
aaaatcgtgtttctgccttcatattctcatcaaaaagtgttttttcactgacctaggtgtttgccttatataggcgcgtattttccttaaaattagtgaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
20037124 |
aaaatcgtgtttctgccttcatattctcatcaaaaagtgttttttcactgaccaaggtgtttgccttatataggtgcgtattttccttaaaattagtgaa |
20037223 |
T |
 |
| Q |
119 |
agttggcccgcgattttagcatataaattgcgatgttagttaaacatagagtgaacaccttgcatgtcattcatctctc |
197 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20037224 |
agttggcccgcgatgttagcatataaattgcgatgttagttaaacatagagtgaacaccttgcatgtcattcatatctc |
20037302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 19 - 137
Target Start/End: Original strand, 20047254 - 20047372
Alignment:
| Q |
19 |
aaaatcgtgtttctgccttcatattctcatcaaaaagtgttttttcactgacctaggtgtttgccttatataggcgcgtattttccttaaaattagtgaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20047254 |
aaaatcgtgtttctgccttcatattctcatcaaaaagtgttttttcactgacctaggtgtttgccttatataggcacgtattttccttaaaattagtgaa |
20047353 |
T |
 |
| Q |
119 |
agttggcccgcgattttag |
137 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
20047354 |
agttggcccgcgatgttag |
20047372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 148 - 189
Target Start/End: Original strand, 20047363 - 20047404
Alignment:
| Q |
148 |
gcgatgttagttaaacatagagtgaacaccttgcatgtcatt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20047363 |
gcgatgttagttaaacatagagtgaacaccttgcatgtcatt |
20047404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University