View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12314_low_9 (Length: 241)
Name: NF12314_low_9
Description: NF12314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12314_low_9 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 19 - 241
Target Start/End: Complemental strand, 43383748 - 43383523
Alignment:
| Q |
19 |
cacgtttccaccacgagtcattgtgtcatcgtgaggcgtcatgaatgtccttccagtagtagaattagaagaagcggttattgttgt------attggcg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43383748 |
cacgtttccaccacgagtcattgtgtcatcgtgaggcgtcatgaacgtccttccagtagtagaattagaagaagcggttattgttgttgttgtattggcg |
43383649 |
T |
|
| Q |
113 |
aaacagcccttgacattcttgtgactagccctatgtcctccaagtgcctgatgggatccaaatactttgttacaacatgaacacacaaactgatcattct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| || |
|
|
| T |
43383648 |
aaacagcccttgacattcttgtgactagccctgtgtcctccaagtgcctgatgggatccaaatactttgttacaacacgaacacacaaactgatcatcct |
43383549 |
T |
|
| Q |
213 |
catcgaccatcaccgttgttgttgatttt |
241 |
Q |
| |
|
||||||| |||||||||||||| |||| |
|
|
| T |
43383548 |
catcgac---caccgttgttgttgctttt |
43383523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 109 - 236
Target Start/End: Complemental strand, 25870382 - 25870258
Alignment:
| Q |
109 |
ggcgaaacagcccttgacattcttgtgactagccctatgtcctccaagtgcctgatgggatccaaatactttgttacaacatgaacacacaaactgatca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
25870382 |
ggcgaaacagcccttgacattcttgtgactagccctgtgtcctccaagtgcctgatgggatccaaatactttgttgcaacacgaacacacaaactgatc- |
25870284 |
T |
|
| Q |
209 |
ttctcatcgaccatcaccgttgttgttg |
236 |
Q |
| |
|
|||||| ||| |||||||||||||| |
|
|
| T |
25870283 |
--ctcatcatccaccaccgttgttgttg |
25870258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University