View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12315_low_8 (Length: 294)
Name: NF12315_low_8
Description: NF12315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12315_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 19 - 279
Target Start/End: Original strand, 40146922 - 40147180
Alignment:
| Q |
19 |
tcttgtactatatataattgctgcacataacacttcaatttgtctgctgaaattaacagggtttggcaggagttgcctgtgcttgtcattgtcagcatgc |
118 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40146922 |
tcttgtactatatataattgttgaacataacacttcaaattgtctgctgaaattaacagggtttggcaggagttgcctgtgcttgtcattgtcagcatgc |
40147021 |
T |
|
| Q |
119 |
ttgcttatttctgtttcctcgagcagcttttagtaagaataaaagtcctctcatttctctcaaagttacaattcaaagtatagcctcatttattcaactc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40147022 |
ttgcttatttctgtttcctcgagcagcttttagtaagaataaaaatcctctcatttctctcaaagttacaattcaaag--tagcctcatttattcaactc |
40147119 |
T |
|
| Q |
219 |
tctgcaggttggaaaaatgggaaccaaagcaattttcatttctcttccattttcctgtgta |
279 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40147120 |
tctgcaggttgggaaaatgggaaccaaagcaattttcatttctcttccattttcatgtgta |
40147180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University