View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12316_high_9 (Length: 305)
Name: NF12316_high_9
Description: NF12316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12316_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 118 - 256
Target Start/End: Complemental strand, 42776254 - 42776116
Alignment:
| Q |
118 |
attatcgattttttgttatatagttatttctagtttgaacatggagaagcatatgataatgattgcttgaagaagaaggtaatgaagaaagcgttttact |
217 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42776254 |
attatcgattttttgttatacagttatttctagtttgaacatggagcagcatacgataatgattgcttgaagaagaaggtaatgaagaaagcgttttact |
42776155 |
T |
 |
| Q |
218 |
tttgtaggaacacttgctgaaaaggcacttcttgctatt |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42776154 |
tttgtaggaacacttgctgaaaaggcacttcttgctatt |
42776116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 15 - 121
Target Start/End: Complemental strand, 42776448 - 42776342
Alignment:
| Q |
15 |
gtgaagaataacgatattcattgcatcgtaaagacacttctcaacactataagccgccacaccggcttccagcacgacgttggatctttcatgaagtcca |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42776448 |
gtgaagaataacgatattcattgcatcgtaaagacacttctcagcactataagccgccacaccggcttccagcacgacgttggatctttcatgaagtcca |
42776349 |
T |
 |
| Q |
115 |
ggtatta |
121 |
Q |
| |
|
||||||| |
|
|
| T |
42776348 |
ggtatta |
42776342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 218 - 289
Target Start/End: Complemental strand, 760438 - 760367
Alignment:
| Q |
218 |
tttgtaggaacacttgctgaaaaggcacttcttgctattttgcctccttaagatggttttctatatgctgtt |
289 |
Q |
| |
|
||||||||| ||||||||||||| || ||||||||| ||||||||||| ||| || ||||| |||| ||||| |
|
|
| T |
760438 |
tttgtaggagcacttgctgaaaaagctcttcttgctgttttgcctcctgaagttgtttttccatatactgtt |
760367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University