View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12316_low_24 (Length: 215)
Name: NF12316_low_24
Description: NF12316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12316_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 17 - 198
Target Start/End: Complemental strand, 54221379 - 54221198
Alignment:
| Q |
17 |
gtgccctaataccgccgtttcaaatgcattttatcagttgagttatcataaacacgtatgnnnnnnnnnnnnnnnnnnnnnnngcattgtttcgattcac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
54221379 |
gtgccctaataccgccgtttcaaatgcattttatcagttgagttatcataaacacgtatgtttttgttttttcttttccttttgcattgtttcgattcac |
54221280 |
T |
|
| Q |
117 |
tgtgttatatgatcgccttagcagcgctcttgttaatgatgttttgcttgcttagtttcttagcttgtttctgtattgtttt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54221279 |
tgtgttatatgatcgccttagcagcgctcttgttaatgatgttttgcttgcttagtttcttagcttgtttctgtattgtttt |
54221198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 17 - 69
Target Start/End: Complemental strand, 22703758 - 22703705
Alignment:
| Q |
17 |
gtgccctaataccgccgtttcaaatgcat-tttatcagttgagttatcataaac |
69 |
Q |
| |
|
||||||||||||||||||||||| | ||| |||||| ||||||| ||||||||| |
|
|
| T |
22703758 |
gtgccctaataccgccgtttcaattccatctttatcggttgagtaatcataaac |
22703705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University