View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12316_low_26 (Length: 202)
Name: NF12316_low_26
Description: NF12316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12316_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 4586692 - 4586497
Alignment:
| Q |
1 |
atagtttgaggtagttggcagaagaaagtataaatggttcactgcagatccctaaattctatgcatcttcaattttgatctttaaaaataataacagtgc |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4586692 |
atagtttgaggtagttagcagaagaaagtataaatagttcactgcagatccctaaattctatgcatcttcaattatgatctttaaaaataataacagtgc |
4586593 |
T |
 |
| Q |
101 |
gaggaatctagcatgaaataatcttattatcatgaaaaataggaataataacgatagaatgattagtaaatcaatgaaagaatgatg-tgatgatg |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4586592 |
gaggaatctagcatgaaataatcttattatcatgaaaaataggaataataacgatagaatgattagtaaatcaatgaaagaatgatgatgatgatg |
4586497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University