View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12316_low_5 (Length: 380)
Name: NF12316_low_5
Description: NF12316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12316_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 1e-69; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 17 - 158
Target Start/End: Original strand, 8336165 - 8336306
Alignment:
| Q |
17 |
ataatgtgatatccaatcaaaggtgagcaagtaatagttgtgtttggagatatatgtttaggcaaataatatttacaaaggtagtaaataaaatgaagtt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8336165 |
ataatgtgatatccaatcaaaggtgagcaagtaatagttgtgtttggagatatatgtttgggcaaataatatttacaaaggtagtaaataaaatgaagtt |
8336264 |
T |
|
| Q |
117 |
aactcatttaaataaacgtgaataaattgttgttctataata |
158 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8336265 |
aactcatttaaataaacatgaataaattgttgttctataata |
8336306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University