View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12317_high_2 (Length: 326)
Name: NF12317_high_2
Description: NF12317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12317_high_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 84 - 312
Target Start/End: Original strand, 15964910 - 15965149
Alignment:
| Q |
84 |
gaattttgtggtcatttgtgatggagttggaggcttttagcttattatttggatgctgctggtttaagggggttttgttgggttttggtgtaggctttgg |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15964910 |
gaattttgtggtcatttgtgatggagttggaggcttttagcttattatttggatgctgctggtttaagggggttttgttgggttttggtgtaggctttgg |
15965009 |
T |
 |
| Q |
184 |
agg------------nnnnnnnnattggtgttgatgatagccattgtggaattgtgtctttattggtgtttatgatgtacgatatatgtgttttcttcta |
271 |
Q |
| |
|
||| ||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
15965010 |
aggtttttttttctttttctttaattggtgttgatgatagccgttgtggaattgtgtctttattgatgtttatgatgtacgatatatgtgttttcttcta |
15965109 |
T |
 |
| Q |
272 |
ggtgtttcgactatgtacgacaccttttgatatgtagtttc |
312 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15965110 |
ggtgtttcgactatgtacga-accttttgatatgtagtttc |
15965149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 40796743 - 40796794
Alignment:
| Q |
223 |
ttgtgtctttattggtgtttatgatgtacgatatatgtgttttcttctaggt |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||||| ||||| |
|
|
| T |
40796743 |
ttgtgtctttattggtgtttatgatgtacgatgtatgtattttcttttaggt |
40796794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 252
Target Start/End: Complemental strand, 536690 - 536661
Alignment:
| Q |
223 |
ttgtgtctttattggtgtttatgatgtacg |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
536690 |
ttgtgtctttattggtgtttatgatgtacg |
536661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University