View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12317_high_5 (Length: 310)
Name: NF12317_high_5
Description: NF12317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12317_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 249; Significance: 1e-138; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 29 - 293
Target Start/End: Complemental strand, 34139732 - 34139468
Alignment:
| Q |
29 |
atgaatgaccacatcaagaggtacacaaaacttacatagccatagcacaacgctaaggccgttgccttatgattcgaaggtcatatttaaatcgtaaaat |
128 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34139732 |
atgaatcaccacatcaagaggtacgcaaaacttacatagccatagcgcaacgctaaggccgttgccttatgattcgaaggtcatatttaaatcgtaaaat |
34139633 |
T |
|
| Q |
129 |
tgctctccacttgacttcgccgatttaaatcctgaaaaatgtttgtcggtttacaaagacaagacttcatagagtgcattgggatgtccaaaatgattta |
228 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34139632 |
tgctctccacttgacttcgcggatttaaatcctgaaaaatgtttgtcggtttacaaagacaagacttcatagagtgcattgggatgtccaaaatgattta |
34139533 |
T |
|
| Q |
229 |
acgagagacttgagtttattgttacaggtttggagtaatgatgccaatgagagtgtggagcacag |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34139532 |
acgagagacttgagtttattgttacaggtttggagtaatgatgccaatgagagtgtggagcacag |
34139468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 227 - 290
Target Start/End: Complemental strand, 34136582 - 34136519
Alignment:
| Q |
227 |
taacgagagacttgagtttattgttacaggtttggagtaatgatgccaatgagagtgtggagca |
290 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34136582 |
taacgagagacttgggtttattgttgcaggtttggagtaatgatgcctatgagagtgtggagca |
34136519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 224 - 293
Target Start/End: Complemental strand, 34142217 - 34142148
Alignment:
| Q |
224 |
atttaacgagagacttgagtttattgttacaggtttggagtaatgatgccaatgagagtgtggagcacag |
293 |
Q |
| |
|
|||||||| |||| ||| |||||||||| |||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
34142217 |
atttaacgggagaattgggtttattgttgtaggtttggagcaatgatgcctatgagagtgtggagcacag |
34142148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University