View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12318_low_1 (Length: 268)
Name: NF12318_low_1
Description: NF12318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12318_low_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 19 - 260
Target Start/End: Original strand, 3324274 - 3324523
Alignment:
| Q |
19 |
taatcagttctattttctcaaattattactaaagtctgcatgttagtatcagtgtcgtgtttgacgtttgtgccgatgtttaatttattgtcatgtgcat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3324274 |
taatcagttctattttctcaaattattactgaagtctacatgttagtatcagtgtcgtgtttgacgtttgtgccgatatttaatttattgtcatgtgcat |
3324373 |
T |
 |
| Q |
119 |
aa--------aatacaacaatacttgtatgcaaaatttaatggtgaaaagagaatgttacccttttatatgcatcataatcatgtccactcctaagaagc |
210 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3324374 |
aatatgaatcaatacaacaatacttgtatgcaaaatttaatggtgaaaagagaatattacccttttatatgcatcataatcatgtccactcctaagaagc |
3324473 |
T |
 |
| Q |
211 |
tcagcaatgtcattcttcgtaaacttctgaatagctcttctcttcttctc |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3324474 |
tcagcaatgtcattcttcgtaaacttctgaatagctcttctcttcttctc |
3324523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 81
Target Start/End: Original strand, 8013863 - 8013924
Alignment:
| Q |
20 |
aatcagttctattttctcaaattattactaaagtctgcatgttagtatcagtgtcgtgtttg |
81 |
Q |
| |
|
||||| || |||||| |||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
8013863 |
aatcacttatattttttcaaattattactagtgtctacatgttagtatcagtgtcgtgtttg |
8013924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 1116428 - 1116368
Alignment:
| Q |
19 |
taatcagttctattttctcaaattattactaaagtctgcatgttagtatcagtgtcgtgtt |
79 |
Q |
| |
|
|||||| ||| |||||||||||||||||| || |||| ||||||||| ||||||| ||||| |
|
|
| T |
1116428 |
taatcacttcaattttctcaaattattaccaatgtctacatgttagtgtcagtgttgtgtt |
1116368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University