View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12319_low_2 (Length: 313)
Name: NF12319_low_2
Description: NF12319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12319_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 19 - 225
Target Start/End: Original strand, 409627 - 409833
Alignment:
| Q |
19 |
aagttgttggtagagctggtgttgggattgataatgtggatctacaagctgctactgaatttggttgtcttgttgtgaatgctcctacagctaatactat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
409627 |
aagttgttggtagagctggtgttgggattgataatgtggatctacaagctgctactgaatttggttgtcttgttgtgaatgctcctactgctaatactat |
409726 |
T |
 |
| Q |
119 |
tgctgctgctgaacatgggattgctcttcttgctgctatggctcgtaacgtttctcaagctgatgcttcccttaaagcaggtatggtacatgttcatgat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | |||||| |
|
|
| T |
409727 |
tgctgctgctgaacatgggattgctcttcttgctgctatggctcgtaacgtttctcaagctgatgcttcccttaaagctggtatggtacatttacatgat |
409826 |
T |
 |
| Q |
219 |
ttatctt |
225 |
Q |
| |
|
||||||| |
|
|
| T |
409827 |
ttatctt |
409833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 21 - 139
Target Start/End: Original strand, 48784678 - 48784796
Alignment:
| Q |
21 |
gttgttggtagagctggtgttgggattgataatgtggatctacaagctgctactgaatttggttgtcttgttgtgaatgctcctacagctaatactattg |
120 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||| || ||||||||| |||||| | ||||| |||||||| || ||||| ||| ||| |
|
|
| T |
48784678 |
gttgttggtagagctggtgttggtattgataacgtggatctggccgccgctactgaacatggttgcttggttgttaatgctcccactgctaacactgttg |
48784777 |
T |
 |
| Q |
121 |
ctgctgctgaacatgggat |
139 |
Q |
| |
|
| || |||||||| ||||| |
|
|
| T |
48784778 |
ccgccgctgaacacgggat |
48784796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University