View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12319_low_6 (Length: 238)
Name: NF12319_low_6
Description: NF12319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12319_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 125 - 224
Target Start/End: Complemental strand, 18886125 - 18886026
Alignment:
| Q |
125 |
atttttagctcctttccatgaactgacatttgtcattaatcacatttatttcaaaataatatgccttataaatcacatcattcatctattgacttcacag |
224 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
18886125 |
atttttagcttctttccatgaactgacattttccattaatcacatttatttcaaaatagtatgctttataaatcacatcattcatctattgacttcacag |
18886026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University