View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12319_low_8 (Length: 206)
Name: NF12319_low_8
Description: NF12319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12319_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 16 - 196
Target Start/End: Complemental strand, 37454142 - 37453962
Alignment:
| Q |
16 |
gacatcatttgcaaatggaggagttacttactttggattcagtgcatctttcagatcaagttcttgaggttgatatggagaaaagtaacatgattcataa |
115 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37454142 |
gacatcatttgcatctggaggagttacttactttggattcagtgcatctttcagatcaagttcttgaggttgatatggagaaaagtaacatgattcataa |
37454043 |
T |
 |
| Q |
116 |
gcttatttcactaaaagagaaagatgaatattcgtgtaatgaagagccaactggagagatggatatttcaaaacacaggtt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37454042 |
gcttatttcactaaaagagaaagatgaatattcgtgtaatgaagagccaactggagagatggatatttcaaaacacaggtt |
37453962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 108 - 181
Target Start/End: Original strand, 1655831 - 1655904
Alignment:
| Q |
108 |
attcataagcttatttcactaaaagagaaagatgaatattcgtgtaatgaagagccaactggagagatggatat |
181 |
Q |
| |
|
|||| ||||||||||||||| | |||| |||| |||||||| |||| ||||||| |||| |||||||||||| |
|
|
| T |
1655831 |
attcttaagcttatttcactgagagaggaagaagaatattcaagtaaggaagagcagactgtagagatggatat |
1655904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University