View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12320_high_13 (Length: 220)
Name: NF12320_high_13
Description: NF12320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12320_high_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 19 - 177
Target Start/End: Original strand, 28099045 - 28099203
Alignment:
| Q |
19 |
tagtacagttcaaacatgtaattaattgtaattaattgcatacagtgaatggtgaataaatataacacattgtctcaactcatcgattataatactagtg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28099045 |
tagtacagttcaaacatgtaattaattgtaattaattgcatacagtgaatggtgaataaatataacacattgtctcaactcatcgattataatactagtg |
28099144 |
T |
 |
| Q |
119 |
catatatatcttttaaattcttcgactaaattcttctccaacttataacactttttcag |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28099145 |
catatatatcttttaaattcttcgactaaattcttctccaacttataacactttttcag |
28099203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University