View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12322_high_7 (Length: 311)
Name: NF12322_high_7
Description: NF12322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12322_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 18 - 301
Target Start/End: Original strand, 14294622 - 14294904
Alignment:
| Q |
18 |
ctcactttggtcttaatttgttcattttattgaaaaaagtaggnnnnnnnnatgtgaaattctactacatgttatttggacaagttttgtttcattttta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14294622 |
ctcactttggtcttaatttgttcattttattgaaaaaagtaggttttttt-atgtgaaattctactacatgttatttggacaagttttgtttcattttta |
14294720 |
T |
 |
| Q |
118 |
gaatagataattggattaaagttactgctgagtttgactttatgtatttatttggagtatttactattttggtcttttttcatgtacttggttagttttt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
14294721 |
gaatagataattggattaaagttactgctgagtttgagtttatgtatttatttggagtatttactattttggtcttttttcatgtactaggttagttttt |
14294820 |
T |
 |
| Q |
218 |
cgttgtactttatgagaatttggttgaataagtaatggaatttttagttggcaatgtgtagtttatgctgtccttttgtctgtg |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
14294821 |
cgttgtactttatgagaatttggttgaataagtaatggaatttttagttggtaatgtgtagtttatgctgtccttttgtgtgtg |
14294904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University