View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12322_low_9 (Length: 280)
Name: NF12322_low_9
Description: NF12322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12322_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 19 - 268
Target Start/End: Complemental strand, 18140566 - 18140316
Alignment:
| Q |
19 |
gtaagtactactcaattgatagcctgaatatttgttgtgttggggcgtgagtttgaacttacaattctcatttctccacacgtaacatgtgcgattctcg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18140566 |
gtaagtactactcaattgatagcctgaatatttgttgtgttggggcgtgagtttgaacttgcaattctcatttctccacacgtaacatgtgcgattctcg |
18140467 |
T |
 |
| Q |
119 |
gcactagactacttaatnnnnnnn-tacatagataaatacgacatattaattattatcatttaaattgaatttcttttcatatgatctcattaactgtgt |
217 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18140466 |
gcactagactacttaataaaaaaaatacatagataaatacgacatattaattattatcatttaaattgaatttcttttcatatgatctcattaactgtgt |
18140367 |
T |
 |
| Q |
218 |
catgactgctctattgcggcatagaccattgcaaactctacatctctgctt |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
18140366 |
catgactgctctattgcggcatagaccattgcaaactctacatctatgctt |
18140316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University