View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12325_high_6 (Length: 229)
Name: NF12325_high_6
Description: NF12325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12325_high_6 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 12 - 229
Target Start/End: Complemental strand, 43866739 - 43866522
Alignment:
| Q |
12 |
ctgtgttgcggctttgcttgtgctacaagtaatctttttcttggctttagcagaagatctttttcgaaagtctcttggagggttttgatccaaattcaga |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43866739 |
ctgtgttgcggctttgcttgtgctacaagtaatctttttcttggctttagcagaagatctttttcgaaagtctcttggagggttttgatccaaattcaga |
43866640 |
T |
|
| Q |
112 |
ctcttgatatattcttgcagaagagtccctcttggatacttcgaaagacatgttcttttggaatattgccttctctttgttgcattcctatggtttttta |
211 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43866639 |
ctcttgatatattcttgcaaaagagtccctcttggatacttcgaacgacatgttcttttggaatattgccttctctttgttgcattccaatggtttttta |
43866540 |
T |
|
| Q |
212 |
ttgcgttgccagttcttc |
229 |
Q |
| |
|
|||| || ||||||||| |
|
|
| T |
43866539 |
ttgcattctcagttcttc |
43866522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 164 - 229
Target Start/End: Complemental strand, 34916898 - 34916833
Alignment:
| Q |
164 |
ttcttttggaatattgccttctctttgttgcattcctatggttttttattgcgttgccagttcttc |
229 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||| ||||||||| |||| ||| ||||||||| |
|
|
| T |
34916898 |
ttcttttggagtattgtcttctctttgttgcattccaatggtttttgattgagttttcagttcttc |
34916833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University