View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12325_low_3 (Length: 375)
Name: NF12325_low_3
Description: NF12325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12325_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 3e-61; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 98 - 217
Target Start/End: Complemental strand, 37306014 - 37305895
Alignment:
| Q |
98 |
tcatgttattgatgtttttgtttcctttttgaagtggcacattaatctcattgaaacaccgctaaagctgacagaagaatctaacaaagaattcatcatc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37306014 |
tcatgttattgatgtttttgtttcctttttgaagtggcacattaatctcattgaaacaccgctaaagctgacagaagaatctaacaaagaattcatcatc |
37305915 |
T |
 |
| Q |
198 |
tgaaagccatttaaggatct |
217 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
37305914 |
tgaaagccatttaaggatct |
37305895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 248 - 375
Target Start/End: Complemental strand, 37305864 - 37305739
Alignment:
| Q |
248 |
gattttctagttgaagcttttttgattgtgaaatatgcaagctggtttaatgattccagctagtaacatgcattcaatgatcggaagaaacaacaataac |
347 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37305864 |
gattttctagttgaagcttttttgattg--aaatatgcaagctggtttaatgattccagctagtaacatgcattcaatgatcggaagaaacaacaataac |
37305767 |
T |
 |
| Q |
348 |
gttggtgtctttggtttatcttcatctc |
375 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
37305766 |
gttggtgtctttggtttatcttcatctc |
37305739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University