View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12325_low_5 (Length: 247)
Name: NF12325_low_5
Description: NF12325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12325_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 39471153 - 39471392
Alignment:
| Q |
1 |
gatatgagaactgtatggcatgagattgaaatgtttgtctttatattatttatgggagaattgatggatggtgaaggctatttactactaccttatatat |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39471153 |
gatatgagaactttatggcatgagattgaaatgtttgtctttatattatttatgggagaattgatggatggtgaaggctatttactactaccttatatat |
39471252 |
T |
 |
| Q |
101 |
ggaccgtgcaagtttttgtggtgtacaagaatatgtaaaaactatctgnnnnnnnnnnnnnnnnntgtaaaactagattgttgttattatcttgttggaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39471253 |
ggaccgtgcaagtttttgtggtgtacaagaatatgtaaaaactatctgaaaaaaggaaaaaaaaatgtaaaactggattgttgttattatcttgttggaa |
39471352 |
T |
 |
| Q |
201 |
ttatttattattcaataatatgtgtggtgtgtggtctgtg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39471353 |
ttatttattattcaataatatgtgtggtgtgtggtgtgtg |
39471392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University