View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12325_low_8 (Length: 215)
Name: NF12325_low_8
Description: NF12325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12325_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 43866530 - 43866322
Alignment:
| Q |
1 |
cagttcttcctggcaatcttttcgcaatctccgcccacttatctcctatctctgtatgagcttggatcaatatcttatcctcttcatctgtccatacgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43866530 |
cagttcttcctggcaatcttttcgcaatctccgcccacttatttcctatctctgtatgagcttggatcaatatcttatcctcttcatctgtccatacgtc |
43866431 |
T |
|
| Q |
101 |
tttctgcaaaaatgcacgaattgaagtttaatatagaaggaaaattcgtatgaacaaatttgtatcatgcaatcatcgaactctttttgtgagaatgtag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43866430 |
tttctgcaaaaatgcacgaattgaagtttaatatagaaggaaaattcgtatgaacaaatttgtatcatgcaatcatcgaactctttttgtgagaatgtag |
43866331 |
T |
|
| Q |
201 |
agatactta |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
43866330 |
agatactta |
43866322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 34916841 - 34916733
Alignment:
| Q |
1 |
cagttcttcctggcaatcttttcgcaatctccgcccacttatctcctatctctgtatgagcttggatcaatatcttatcctcttcatctgtccatacgtc |
100 |
Q |
| |
|
||||||||||||| || ||||| || ||||| ||||| || | |||||||||| ||| |||| ||||||||| || |||||||| || |||||| ||| |
|
|
| T |
34916841 |
cagttcttcctggtaaccttttagctatctctgcccatttgtttcctatctcttcatgtgctttgatcaatatgttgtcctcttcctcactccatatgtc |
34916742 |
T |
|
| Q |
101 |
tttctgcaa |
109 |
Q |
| |
|
|||||||| |
|
|
| T |
34916741 |
cttctgcaa |
34916733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University