View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12326_high_17 (Length: 215)
Name: NF12326_high_17
Description: NF12326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12326_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 5e-92; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 14 - 200
Target Start/End: Original strand, 25632638 - 25632823
Alignment:
| Q |
14 |
cataggtttcatgcatgggaggttattacgtgctttcactcaccaacattttcaatgtgaatcaacaattgcatgttcttactacaagccttttgctttg |
113 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25632638 |
cataggtttcatgcatgggaggt-attacgtgcttccactcaccaacattttcaatgtgaatcaacaattgcatgttcttactacaagccttttgctttg |
25632736 |
T |
 |
| Q |
114 |
gtgggatgggttgtaaaattgaatttaaattgagctcaatacaattcatatcagttcacttgttggttcgatctcaattgaatataa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25632737 |
gtgggatgggttgtaaaattgaatttaaattgagctcaatataattcatatcagttcacttgttggttcgatctcaattgaatataa |
25632823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 140 - 195
Target Start/End: Original strand, 25644127 - 25644182
Alignment:
| Q |
140 |
aaattgagctcaatacaattcatatcagttcacttgttggttcgatctcaattgaa |
195 |
Q |
| |
|
||||||||||| ||||||| | ||||||||||||||||||||| ||| || ||||| |
|
|
| T |
25644127 |
aaattgagctcgatacaatccttatcagttcacttgttggttcaatcccatttgaa |
25644182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 117
Target Start/End: Original strand, 25644073 - 25644121
Alignment:
| Q |
69 |
tgtgaatcaacaattgcatgttcttactacaagccttttgctttggtgg |
117 |
Q |
| |
|
|||| |||||||||||||||||||||||| || | ||||| |||||||| |
|
|
| T |
25644073 |
tgtgcatcaacaattgcatgttcttactataaacgttttgttttggtgg |
25644121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University