View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12326_low_17 (Length: 241)

Name: NF12326_low_17
Description: NF12326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12326_low_17
NF12326_low_17
[»] chr5 (1 HSPs)
chr5 (16-225)||(330598-330807)


Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 16 - 225
Target Start/End: Original strand, 330598 - 330807
Alignment:
16 agagattaagaatgaaaggaatgcatggatgcatgcatgagagagggaattatgtaattaacgtacgtaccatccttctaaacaaccagggccgcttgaa 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||    
330598 agagattaagaatgaaaggaatgcatggatgcatgcatgagagagggaattatataattaacgaacgtaccatccttctaaacaaccagggccgcttgaa 330697  T
116 ttgttgtgattgtgtacatgttgaggaggtggaggttgagcgtattgaggaggagcatattgtggaggatacccttgtgctgggtagggtggtggaggat 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
330698 ttgttgtgattgtgtacatgttgaggaggtggaggttgagcgtattgaggaggagcatattgtggaggatacccttgtgctgggtagggtggtggaggat 330797  T
216 atccttgttg 225  Q
    ||||||||||    
330798 atccttgttg 330807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University