View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12326_low_19 (Length: 223)
Name: NF12326_low_19
Description: NF12326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12326_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 13 - 206
Target Start/End: Original strand, 55930825 - 55931019
Alignment:
| Q |
13 |
agcagagaagatgctcagagggctattaacaaactcaatgggtattgcttcaagaatctcttcaatatgttttaagggcgacccaaagaacaacctaagt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55930825 |
agcagagaagatgctcagagggctattaacaaactcaatgggtattgcttcaagaatctcttcaatatgttttaagggcgacccaaagaacaacctaagt |
55930924 |
T |
|
| Q |
113 |
ataaatattggctgcttttgagta-nnnnnnnattgcccccctttttcttctttgaatatttgtagcaataatctgagttctggaccatttgttt |
206 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55930925 |
ataaatattggctgcttttgagtattttttttattgcccccctttttcttctttgaatatttgtagcaataatctgagttctggaccatttgttt |
55931019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 13 - 53
Target Start/End: Original strand, 45340704 - 45340744
Alignment:
| Q |
13 |
agcagagaagatgctcagagggctattaacaaactcaatgg |
53 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
45340704 |
agcagggaagatgctcagagggctatcaacaaactcaatgg |
45340744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University