View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12328_low_2 (Length: 437)
Name: NF12328_low_2
Description: NF12328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12328_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 3e-89; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 3e-89
Query Start/End: Original strand, 192 - 424
Target Start/End: Original strand, 34159271 - 34159484
Alignment:
| Q |
192 |
caaagtatttaattattatacttgggaagaagaccctttatttatcatgaggcattctagtgatgcacttgagtttgttgctattttcacttgtaagata |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34159271 |
caaagtatttaattattatacttgggaagaagaccctttatttatcatgaggcattctagtgatgcacttgagtttgttgctattttcacttgtaagata |
34159370 |
T |
|
| Q |
292 |
tggttcagtttgctgagtgcagctaaattcgaaatagatgtggctgtctatcagattcgaatgcatccttagataatagggattgtttagtgattatttg |
391 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34159371 |
tggttcagtttgctgagtgcaactaaattcgaaatagat-------------------gaatgcatccttagataatagggattgtttagtgattatttg |
34159451 |
T |
|
| Q |
392 |
atagtttattggtgttgatggcgatggagcaca |
424 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34159452 |
atagtttattggtgttgatggcgatggagcaca |
34159484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 26 - 94
Target Start/End: Original strand, 34159157 - 34159223
Alignment:
| Q |
26 |
tgacactttgtcactctaaaatgaaaagagaataatccaaatacacaaaacttggaacacactaaaagg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
34159157 |
tgacactttgtcactctaaaatgaaaagagaattatccaaat--acaaaacttggaacacactaaaagg |
34159223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University