View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12328_low_4 (Length: 239)
Name: NF12328_low_4
Description: NF12328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12328_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 6 - 221
Target Start/End: Original strand, 53694472 - 53694687
Alignment:
| Q |
6 |
aggaggagcagagaatgacctatgcattcaattttgttttctgttaacattatattgtaacaactgcttcaagagttgtaaagatgaattatcctatcaa |
105 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53694472 |
aggagcagaagagaatgacctatgcattcaattttgttttctgttaacattatattgtaacaactgcttcaagagttgtaaagatgaattatcctatcaa |
53694571 |
T |
 |
| Q |
106 |
taaaaattcaattttgttttctcctaacaattggtctaacatgccgctatctaggggaagtgccagcgacttgcgacaacaatggaagttcatgtggaga |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53694572 |
taaaaattcaattttgttttctcctaacaattggtctaacatgccgctatctaggggaaacgccagcgacttgcgacaacaatggaagttcatgtggaga |
53694671 |
T |
 |
| Q |
206 |
atttgaaggcctcttt |
221 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
53694672 |
atttgaaggcctcttt |
53694687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University