View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12329_low_3 (Length: 375)
Name: NF12329_low_3
Description: NF12329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12329_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 11 - 363
Target Start/End: Complemental strand, 27967335 - 27966982
Alignment:
| Q |
11 |
atggacatcaattaacttgcattgtttatacggcttaaaacattgtctcaacagtgtgccatatttcattgccaatccttcgtcatttatatttgtccat |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27967335 |
atggacatcaattaacttgcattgtttatacggctgaaaacattgtctcaacagtgtgccatatttcattgccaatccttcgtcatttatatttgtccat |
27967236 |
T |
|
| Q |
111 |
tcttgatgatatttttggatgggatatttctatcttactgttttcctcatcttcctaaggaccacaggatacctattattgattccagcatgatctgcac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27967235 |
tcttgatgatatttttggatgggatatttctatcttactgttttcctcatcttcctaaggaccacaggatacctattattgattccagcatgatctgcac |
27967136 |
T |
|
| Q |
211 |
gatgttaaattgcagactgtagagtggtctccaccctcaaatttaaggacc-acatgatccaatagtgagaccaattcaaagaaacagatagtgagggaa |
309 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
27967135 |
gatgttaaattgcagactgtagagtggcctccaccctcaaatttaaggaccaacatgatccaataatgagaccaattcaaagaaacagatagtgagggaa |
27967036 |
T |
|
| Q |
310 |
agcgaaataaatcactgaaagccacatcaagatcaactttagcaaaccaccaca |
363 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27967035 |
agcgaaataaatcactgaaagccacatcaagatcaactttagcaaaccaccaca |
27966982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University