View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12330_low_1 (Length: 412)
Name: NF12330_low_1
Description: NF12330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12330_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-115; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 121 - 365
Target Start/End: Original strand, 29753629 - 29753878
Alignment:
| Q |
121 |
ttgaaagcaagagatatcgtgattatatgtagttcttcatttagatttcatgttttcatttgataggccaaggaaaatgcagatatgaaattcatttgcc |
220 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29753629 |
ttgaaagcaagagatatcgtgattat--gtagttcttgatttagatttcatgttttcatttgataggccaaggaaaatgcagatatgaaattcatttgcc |
29753726 |
T |
|
| Q |
221 |
aactagatatattttatggtcagttagtgataggaaaaacaaaatccaaaggttctgttacatggttaatcatgaatgacaaagaaataagttgaagata |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29753727 |
aactagatatattttatggtcagttagtgataggaaaaacaaaatccaaaggttctgttacatggttaatcatgaatgacaaagaaataagttgaagata |
29753826 |
T |
|
| Q |
321 |
tat-------aattacaaagaactttttatgaaactagagattcactattgt |
365 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29753827 |
tatattttcaaattacaaagaactttttatgaaactagagattcactattgt |
29753878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 29752973 - 29753056
Alignment:
| Q |
18 |
tatttttgacaaagtgtgcttgaatgtctcaagaaacttgtattcaagcatatatggtttgcatgttttattaatcagattatc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29752973 |
tatttttgacaaagtgtgcttgaatgtctcaagaaacttgtattcaagcatatatggtttgcatgttttattaatcagattatc |
29753056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University