View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12330_low_7 (Length: 244)
Name: NF12330_low_7
Description: NF12330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12330_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 18 - 234
Target Start/End: Complemental strand, 7921230 - 7921014
Alignment:
| Q |
18 |
ctataaatatatgctgcagctgcatgagataggattatattgtgaaccgtcagatatggctccttctctgaatctccttcactacaatttccaaatggtt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7921230 |
ctataaatatatgctgcagctgcatgagataggattatattgtgaaccgccagatatggctccttctctgaatctccttcactacaatttccaaatggtt |
7921131 |
T |
|
| Q |
118 |
tagagcaacgaaatggcggagctattcctttgcggtagccgtatgtgatcagataatctggctcattgaaggttgcccaatattttaccctgtcaccaaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7921130 |
tagagcaacgaaatggcggagctattcctttgcggtagccgtatgtgatcagataatctggctcattgaaggttgcccagtattttaccctgtcaccaaa |
7921031 |
T |
|
| Q |
218 |
tgatttgaaacacaggt |
234 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
7921030 |
tgatttgaaacaaaggt |
7921014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 19 - 223
Target Start/End: Complemental strand, 46726627 - 46726426
Alignment:
| Q |
19 |
tataaatatatgctgcagctgcatgagataggattatattgtgaaccgtcagatatggctccttctctgaatctccttcactacaatttccaaatggttt |
118 |
Q |
| |
|
||||||||||| |||||||| |||| |||||||||| |||||| | || ||||| |||||||||||||||||||| ||| ||||||||| ||||||| |
|
|
| T |
46726627 |
tataaatatatactgcagctacatgtgataggattacattgtggaaaaccaaatatgcctccttctctgaatctcctttactgcaatttccagatggttt |
46726528 |
T |
|
| Q |
119 |
agagcaacgaaatggcggagctattcctttgcggtagccgtatgtgatcagataatctggctcattgaaggttgcccaatattttaccctgtcaccaaat |
218 |
Q |
| |
|
||||||||| |||| ||| | | || | || |||| ||||| | ||||||||||||||||| |||| |||||||||| |||||| ||||||||||| |
|
|
| T |
46726527 |
agagcaacgtcatggtggatccagtcttctgtggta---gtatgcggccagataatctggctcatcgaagtttgcccaatactttaccttgtcaccaaat |
46726431 |
T |
|
| Q |
219 |
gattt |
223 |
Q |
| |
|
||||| |
|
|
| T |
46726430 |
gattt |
46726426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University