View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12330_low_8 (Length: 214)
Name: NF12330_low_8
Description: NF12330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12330_low_8 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 49; Significance: 3e-19; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 166 - 214
Target Start/End: Complemental strand, 24524519 - 24524471
Alignment:
| Q |
166 |
gctagtcctaggggatttgtttgtttctctatggtagccgtttggtttt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24524519 |
gctagtcctaggggatttgtttgtttctctatggtagccgtttggtttt |
24524471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 24524559 - 24524526
Alignment:
| Q |
1 |
tttctgtccgctgaattgttggtgctgttctgct |
34 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
24524559 |
tttctgtcggctgaattgttggtgctgttctgct |
24524526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 9122610 - 9122575
Alignment:
| Q |
1 |
tttctgtccgctgaattgttggtgctgttctgctgc |
36 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9122610 |
tttctgtcggctgaattgttggtgctgttctgctgc |
9122575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 9130706 - 9130671
Alignment:
| Q |
1 |
tttctgtccgctgaattgttggtgctgttctgctgc |
36 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9130706 |
tttctgtcggctgaattgttggtgctgttctgctgc |
9130671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University