View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12331_low_17 (Length: 289)
Name: NF12331_low_17
Description: NF12331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12331_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 24 - 106
Target Start/End: Complemental strand, 2443413 - 2443331
Alignment:
| Q |
24 |
agtagattgaaaatacatgcgtcaactgctttttaaggttggttgctgtcttgtctttggggttcggatgtgagctgtcctgg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2443413 |
agtagattgaaaatacatgcgtcaactgctttttaaggttggttgctgtcttgtctttggggttcggatgtgagctgtcctgg |
2443331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 189 - 279
Target Start/End: Original strand, 9603400 - 9603490
Alignment:
| Q |
189 |
ttcatttctgtttcggtacttgagttgataatggtaggctgtgttccgctaatagtgatgtcgcttatatatggcattgtgtaggtctgtg |
279 |
Q |
| |
|
||||||||||||||||| |||||||| | |||||||| ||||| | |||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
9603400 |
ttcatttctgtttcggtgcttgagttattggcggtaggctatgttcagataatagtgatgtcgcttatatactgcattgtctaggtctgtg |
9603490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University