View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12331_low_20 (Length: 273)
Name: NF12331_low_20
Description: NF12331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12331_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 259
Target Start/End: Complemental strand, 41796629 - 41796390
Alignment:
| Q |
18 |
atatcaaactaagtccctttcagtgtccaaatgaattgacttcactttagtttagaggatcacttgggattcatattctaaatgatgcatatgtcaaggc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41796629 |
atatcaaactaagtccctttcagtgtccaaatgaattgacttcactttagtttagaggatcacttgggattcatattctaaatgatgcatatgtcaaggc |
41796530 |
T |
 |
| Q |
118 |
attattggattatcggccatttagatgacaaaatcttgggtctctgtcagaaataaaagtcttcattctttttgttggtaccaattggtctgaccaatta |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41796529 |
attattggattatcggccatttagatgacaaaatcttgggtctctgtcagaaataaaagtcttcattctttttgttggtaccaattgatctgaccaatta |
41796430 |
T |
 |
| Q |
218 |
ttttctaccatatctatgtctatagttttatacgattctctg |
259 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41796429 |
ttttctaccatatc--tgtctatagttttatacgattctctg |
41796390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 41762652 - 41762568
Alignment:
| Q |
20 |
atcaaactaagtccctttcagtgtccaaatgaattgacttcactttagtttagaggatcacttgggattcatattctaaatgatg |
104 |
Q |
| |
|
|||||||||||||||||||| | || |||| |||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
41762652 |
atcaaactaagtccctttcaatttcaaaataaattgacttcactttagtttagaggatcacttgggatttttcctctaaatgatg |
41762568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 41792921 - 41792856
Alignment:
| Q |
20 |
atcaaactaagtccctttcagtgtccaaatgaattgacttcactttagtttagaggatcacttggg |
85 |
Q |
| |
|
||||||| |||||||||||| | || |||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
41792921 |
atcaaacaaagtccctttcaatttctaaatgatttgacttcacttttgtttagaggatcacttggg |
41792856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University