View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12331_low_25 (Length: 227)
Name: NF12331_low_25
Description: NF12331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12331_low_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 10 - 210
Target Start/End: Original strand, 34149671 - 34149871
Alignment:
| Q |
10 |
agaagcagagaaactggcttgagtggtcgaagcagtggcaaggtctccactgcacctactgcacctccaactcctcgaactgagggcgagatcttgaagt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34149671 |
agaagcagagaaactggcttgagtggtcgaagcagtggcaaggtctccactgcacctactgcacctccaactcctcgaactgagggcgagatcttgaagt |
34149770 |
T |
|
| Q |
110 |
cttccaatatgaagagcttcacttttagtgagctaaaaactgctacaagaaactttcgtcccgatagtgtggttggcgaaggtggattcggagctgtatt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34149771 |
cttccaatatgaagagcttcacttttagtgagctaaaaactgctacaagaaactttcgtcccgacagtgtggttggcgaaggtggattcggagctgtatt |
34149870 |
T |
|
| Q |
210 |
t |
210 |
Q |
| |
|
| |
|
|
| T |
34149871 |
t |
34149871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University