View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12333_low_5 (Length: 271)
Name: NF12333_low_5
Description: NF12333
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12333_low_5 |
 | |
|
| [»] scaffold0543 (1 HSPs) |
| | |
|
| [»] scaffold0492 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 35 - 139
Target Start/End: Complemental strand, 49971870 - 49971766
Alignment:
| Q |
35 |
ttatgcagggcacattgggaggacccagatattgttccggaatgtcttttatagcatcttacaaagtgttcacttaaaattgacagcagtctaagttgga |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49971870 |
ttatgcagggcacattgggaggacccagatattgttccgaaatgtcttttatcgcatcttacaaagtgttcacttaaaattgacagcagtctaagttgga |
49971771 |
T |
|
| Q |
135 |
agttt |
139 |
Q |
| |
|
||||| |
|
|
| T |
49971770 |
agttt |
49971766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 162 - 264
Target Start/End: Complemental strand, 49971695 - 49971593
Alignment:
| Q |
162 |
tagatacagatgcaaaagaacaaatgttcatggaattatctttgtgcgcaaggaattcaacagtgtgtcaacttttatttatttgaatactgccacaggt |
261 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
49971695 |
tagatacagatgcaaaacaccaaatgttcatggaattatctttgtgcgcaaggaattcggcagtgtgtcaacttttatttatttgcatactgccacaggt |
49971596 |
T |
|
| Q |
262 |
tct |
264 |
Q |
| |
|
||| |
|
|
| T |
49971595 |
tct |
49971593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0543 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0543
Description:
Target: scaffold0543; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 182 - 249
Target Start/End: Complemental strand, 2066 - 1999
Alignment:
| Q |
182 |
caaatgttcatggaattatctttgtgcgcaaggaattcaacagtgtgtcaacttttatttatttgaat |
249 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2066 |
caaatgttcatggaattatatttgtgcccaaggaattcaatcacatgtcaacttttatttatttgaat |
1999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0492 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0492
Description:
Target: scaffold0492; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 182 - 249
Target Start/End: Complemental strand, 3612 - 3545
Alignment:
| Q |
182 |
caaatgttcatggaattatctttgtgcgcaaggaattcaacagtgtgtcaacttttatttatttgaat |
249 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3612 |
caaatgttcatggaattatatttgtgcccaaggaattcaatcacatgtcaacttttatttatttgaat |
3545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University