View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12334_low_4 (Length: 291)
Name: NF12334_low_4
Description: NF12334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12334_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 34 - 271
Target Start/End: Complemental strand, 1022298 - 1022061
Alignment:
| Q |
34 |
ggattaaatgaaatgaattataaaattttcccgcactttctcagtaagcaaacactttcaaaataaaagtcttactcttcaattgactgaaactccgatc |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1022298 |
ggattaaatgaaatgaattataaaattttcccgcactttctcagtaagcaaacactttcaaaataaaagtcttactcttcaattgactgaaactccgatc |
1022199 |
T |
|
| Q |
134 |
aagttgagccctactaatctgcaacatctccgataaccgatctccggccaccgccgctttctcaaaattatctcttatcacttcaacaatctctttcaaa |
233 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1022198 |
aagttgagccctactaatctgcaaaatctccgataaccgatctccggccaccgccgctttctcaaaattatctcttatcacttcaacaatctctttcaaa |
1022099 |
T |
|
| Q |
234 |
tccttatgcttcatcttcaccttttccacattcacctc |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1022098 |
tccttatgcttcatcttcaccttttccacattcacctc |
1022061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University