View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12334_low_5 (Length: 280)
Name: NF12334_low_5
Description: NF12334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12334_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 32 - 273
Target Start/End: Original strand, 1022306 - 1022529
Alignment:
| Q |
32 |
ttatttgtctttattatctcaatttaaatttaaatgtgattaagcttaatttacatttatatatatatctgaagaaattggatttaatattttttgttat |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
1022306 |
ttatttgtctttattatctcaatttaaatttaaacgtgattaagcttaatttacatttatat------ctgaagaatttggatttaat------------ |
1022387 |
T |
 |
| Q |
132 |
ggaaaatattaaattatatacttaattgaaaaatggttattttgaattaaatgcagaaatagtttatcactctagtaatatactgagcaaagtgagctca |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1022388 |
ggaaaatattaaattatatacttaattgaaaaatggttattttgaattaaatgcagaaatagtttatcactctagtaatatactgagcaaagtgagctca |
1022487 |
T |
 |
| Q |
232 |
acttggacctctaagccaccattagcagttaaacacaggttc |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
1022488 |
acttggacctctaagccaccattagcagttaaataccggttc |
1022529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University