View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12338_high_2 (Length: 383)
Name: NF12338_high_2
Description: NF12338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12338_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 7 - 354
Target Start/End: Original strand, 40708510 - 40708857
Alignment:
| Q |
7 |
ggagcagagatggtgggatttttagaagttatgaaggttttaggttctatctgagtttcttggtttggttttccaattttggttgatgttgagtttcaat |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40708510 |
ggagaagagatggtgggatttttagaagttatgaaggttttaggttctatctgagtttcttggtttggttttccaattttggttgatgttgagtttcaat |
40708609 |
T |
|
| Q |
107 |
caattttccatattgggagctaatatgtgatacagtttcaggtaagttttctagcaatttccttagttatagccaatttgatttannnnnnnnagaaaaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40708610 |
caattttccatattgggagctaatatgtgatacagtttcaggtaagttttctagcaatttccttagttatagccaatttgattttttttttttagaaaaa |
40708709 |
T |
|
| Q |
207 |
atagagatgaagagatttgataatccgcttagtggaataaggcttggtcgtccatattgaagagatttgatgaaaattgctgggaataaagagtttatag |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40708710 |
atagagatgaagagatttgataatccgcttagtggaataaggcttggtcgtccatattgaagagatttgatgaaaattgctgggaataaagagtttatag |
40708809 |
T |
|
| Q |
307 |
gataaaagagaacatggaggataaagagtaagggagtgctgagttgtt |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40708810 |
gataaaagagaacatggaggataaagagtaagggagtgctgagttgtt |
40708857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University