View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12339_high_4 (Length: 238)
Name: NF12339_high_4
Description: NF12339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12339_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 54 - 224
Target Start/End: Original strand, 33268890 - 33269060
Alignment:
| Q |
54 |
atgaattgtgtatttggatgtccgatggtccgtcatcaaacgtgcgtctagttgaagttacatgaggtagcttttgatttgcggtgagtttccacattcc |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33268890 |
atgaattgtgtatttggatgtccgatggtccgtcatcaaacgtgcgtctagttgaagttacatgaggtagcttttgatttgcggtgagtttccacgttcc |
33268989 |
T |
 |
| Q |
154 |
aaacacacgaaatcggtctctaaaaattgttagtactttaattttttcttttcagaattttctttagtact |
224 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33268990 |
aaacacacgaaatcggtctctaaaatttgttagtactttaattttttcttttcagaattttctttagtact |
33269060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 33268813 - 33268863
Alignment:
| Q |
1 |
taatttttgtcgagaaattcaatcagtcatttttaaggagatctccactta |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33268813 |
taatttttgtcgagaaattcaatcagtcatttttaaggagatctccactta |
33268863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University