View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12339_low_4 (Length: 356)
Name: NF12339_low_4
Description: NF12339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12339_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 11 - 330
Target Start/End: Original strand, 27022793 - 27023112
Alignment:
| Q |
11 |
gaacctgtggcggagaacacggttggagaatgacggcgacggtgccaatgaacgaccggagattcaacatcaccggagatgataattcacannnnnnnnn |
110 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27022793 |
gaacctgcggcggagaacacggttggagaatgacggcgacggtgccaatgaacgaccggagattcaacatcaccggagatgataattcacatttttttta |
27022892 |
T |
|
| Q |
111 |
nnnnnnnnnnnnnccgtcgggaaaagataaatggaccgaagtccaaaaatgataacggatttgttataggttacttttttcaccacgttagtctactaat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27022893 |
ttttttttattttccgtcgggaaaagataaatggaccgaagtccaaaaatgataacggatttgttataggttacttttttcaccacgttagtctactaat |
27022992 |
T |
|
| Q |
211 |
atcccccctctgatgaaattaatttattttttgccaaaataccttctttttgtttttgtgatctgtcaaaaaataaagtttattgtgttattggaatcaa |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27022993 |
atcccccctctgatgaaattaatttattttttgccaaaataccttttttttttttttgtgatctgtcaaaaaataaagtttattgtgttattggaatcaa |
27023092 |
T |
|
| Q |
311 |
acttgatgtttagaatttac |
330 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
27023093 |
acttgatgtttagaatttac |
27023112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University