View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12340_high_5 (Length: 241)
Name: NF12340_high_5
Description: NF12340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12340_high_5 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 120341 - 120563
Alignment:
| Q |
19 |
atattctatcttatcttaacatgaattcatcgatgaatttttcgatcgttggataccgagttttaagaaaaaagaaaagaacctgatagtagtgagagag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
120341 |
atattctatcttatcttaacatgaattcatcgatgaatttttcgatcgttggataccgagttttaagaaaaaagaaaagaacctgatagtagtgagagag |
120440 |
T |
|
| Q |
119 |
gtattagcacagtgaggacaattgaaaggagcaggagtgtctctgtaaatagtctgttgaataggaatacctttgggatctccgattatcgcgttaggag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
120441 |
gtattagcacagtgaggacaattgaaaggagcaggagtgtctctgtaaatagtctgttgaataggaatacctttgggatctccgattatcgcgttaggag |
120540 |
T |
|
| Q |
219 |
ggataccgttcctttcatatact |
241 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
120541 |
ggataccgttcctttcatatact |
120563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University