View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12340_low_4 (Length: 288)
Name: NF12340_low_4
Description: NF12340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12340_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 3332381 - 3332113
Alignment:
| Q |
1 |
atcatcacacgtgacagcgcaaacgccttgaaaactcacgtgatggaagttgcagacggttgtgacgttgttgaaagtgtcaacaactttgctagacgcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3332381 |
atcatcacacgtgacagcgcaaacgccttgaaaactcacgtgatggaagttgcagacggttgtgacgttgttgaaagtgtcaacaacttcgctagacgcc |
3332282 |
T |
|
| Q |
101 |
gtcaaagaggcgtttgcatcatgagtgggacagggacggttacaaacgtgacactaaggcaaccggcttctcctggggctgttgttacacttcatggaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3332281 |
gtcaaagaggcgtttgcatcatgagtgggacagggacggttacaaacgtgacactaaggcaaccggcttctcctggagctgttgttacacttcatggaag |
3332182 |
T |
|
| Q |
201 |
gttcgagattctttcgctggctggatcgtttcttccaccacctgctccgcccgctgcttctggtttgac |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3332181 |
gttcgagattctttcgctggctggatcgtttcttccaccacctgctccgcccgctgcttctggtttgac |
3332113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University