View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12341_low_5 (Length: 226)
Name: NF12341_low_5
Description: NF12341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12341_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 19 - 210
Target Start/End: Complemental strand, 40843204 - 40843015
Alignment:
| Q |
19 |
gacgaggctttttagcatggtggaacctattggatttgggaagaacggggatatattttacatagtaaatggaaacgaagaagtggaaaggtttaatttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40843204 |
gacgaggctttttagcatggtggaacctattggatttgggaagaacggggatatattttacata--aaatggaaacgaagaagtggaaaggtttaatttg |
40843107 |
T |
|
| Q |
119 |
aataccgacatgattgagaaggttggtgttaaaggaagacatgaatgttgtcaaatggttatctataatgagagccttcttccggaggaatg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40843106 |
aataccgacatgattgagaaggttggtgttaaaggaagacatgaatgttgtcaaatggttatctataatgagagccttcttccggaggaatg |
40843015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 137 - 201
Target Start/End: Complemental strand, 40847270 - 40847206
Alignment:
| Q |
137 |
aaggttggtgttaaaggaagacatgaatgttgtcaaatggttatctataatgagagccttcttcc |
201 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |||||||| || |||||||| |
|
|
| T |
40847270 |
aaggttggtgttaaagaaagacatgaatgttgtcaaatggttatttataatgaaagtcttcttcc |
40847206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University