View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12342_high_3 (Length: 335)

Name: NF12342_high_3
Description: NF12342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12342_high_3
NF12342_high_3
[»] chr5 (1 HSPs)
chr5 (1-322)||(3332113-3332434)
[»] chr8 (1 HSPs)
chr8 (244-322)||(13212814-13212892)
[»] chr1 (3 HSPs)
chr1 (274-322)||(32803230-32803278)
chr1 (274-322)||(16578617-16578665)
chr1 (287-322)||(32809703-32809738)
[»] chr3 (1 HSPs)
chr3 (261-314)||(46200911-46200964)


Alignment Details
Target: chr5 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 1 - 322
Target Start/End: Original strand, 3332113 - 3332434
Alignment:
1 gtcaaaccagaagcagcgggcggagcaggtggtggaagaaacgatccagccagcgaaagaatctcgaaccttccatgaagtgtaacaacagccccaggag 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
3332113 gtcaaaccagaagcagcgggcggagcaggtggtggaagaaacgatccagccagcgaaagaatctcgaaccttccatgaagtgtaacaacagctccaggag 3332212  T
101 aagccggttgccttagtgtcacgtttgtaaccgtccctgtcccactcatgatgcaaacgcctctttgacggcgtctagcaaagttgttgacactttcaac 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
3332213 aagccggttgccttagtgtcacgtttgtaaccgtccctgtcccactcatgatgcaaacgcctctttgacggcgtctagcgaagttgttgacactttcaac 3332312  T
201 aacgtcacaaccgtctgcaacttccatcacgtgagttttcaaggcgtttgcgctgtcacgtgtgatgataatcggtggttttggtttgtttttggatcca 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3332313 aacgtcacaaccgtctgcaacttccatcacgtgagttttcaaggcgtttgcgctgtcacgtgtgatgataatcggtggttttggtttgtttttggatcca 3332412  T
301 gctggtcttcctcttggtcttc 322  Q
    ||||||||||||||||||||||    
3332413 gctggtcttcctcttggtcttc 3332434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 244 - 322
Target Start/End: Original strand, 13212814 - 13212892
Alignment:
244 gcgtttgcgctgtcacgtgtgatgataatcggtggttttggtttgtttttggatccagctggtcttcctcttggtcttc 322  Q
    ||||| |||||||| |  |||||||| || |||||||||||||||||||| || || ||||||||||||||||||||||    
13212814 gcgttcgcgctgtccctcgtgatgatgataggtggttttggtttgtttttcgaacctgctggtcttcctcttggtcttc 13212892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 274 - 322
Target Start/End: Original strand, 32803230 - 32803278
Alignment:
274 ggtggttttggtttgtttttggatccagctggtcttcctcttggtcttc 322  Q
    |||||||||||| ||||||||||||||| ||||||||||||||||||||    
32803230 ggtggttttggtctgtttttggatccaggtggtcttcctcttggtcttc 32803278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 274 - 322
Target Start/End: Complemental strand, 16578665 - 16578617
Alignment:
274 ggtggttttggtttgtttttggatccagctggtcttcctcttggtcttc 322  Q
    |||||||||||||||||||| || || | ||||||||||||||||||||    
16578665 ggtggttttggtttgttttttgaaccgggtggtcttcctcttggtcttc 16578617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 287 - 322
Target Start/End: Original strand, 32809703 - 32809738
Alignment:
287 tgtttttggatccagctggtcttcctcttggtcttc 322  Q
    ||||||||||||||| ||||||||||||||||||||    
32809703 tgtttttggatccaggtggtcttcctcttggtcttc 32809738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 261 - 314
Target Start/End: Complemental strand, 46200964 - 46200911
Alignment:
261 tgtgatgataatcggtggttttggtttgtttttggatccagctggtcttcctct 314  Q
    |||||||||||| |||||||||||||||||||| || |||| ||| | ||||||    
46200964 tgtgatgataataggtggttttggtttgttttttgagccaggtggacgtcctct 46200911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University