View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12342_high_5 (Length: 333)
Name: NF12342_high_5
Description: NF12342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12342_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 112 - 307
Target Start/End: Complemental strand, 11626165 - 11625971
Alignment:
| Q |
112 |
aacttttttgataaattaaagtatgctatctggcgcaattatggatacttaagatttttatatgattaaggagacatttttgttttctgtatcgtgcatg |
211 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11626165 |
aacttttttgataaattaaagtatgttatctcgcgcaattatggatacttaagatttttatatgattaaggagacatttttgttttctgtatcgtgcatg |
11626066 |
T |
|
| Q |
212 |
tttgatatcacggtgactttgtcaaaatcatagactgcaacgaatccactgtgatactaaacatgtactgcgagtatcaattcgctgtgtttattg |
307 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||| |||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
11626065 |
tttgatatcacggtggctttgtc-aaatcatagacggcaacgaatccactgtgatactaaacatgtaccgtgagtatcaattcgctgtgtttattg |
11625971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 11626276 - 11626229
Alignment:
| Q |
1 |
ttatgattgctggtgaggaaaatgtttcgcccgcggcggctatggatg |
48 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11626276 |
ttatgattgatggtgaggaaaatgtttcgcccgcggcggctatggatg |
11626229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University