View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12342_low_1 (Length: 324)
Name: NF12342_low_1
Description: NF12342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12342_low_1 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 10 - 324
Target Start/End: Complemental strand, 38196417 - 38196102
Alignment:
| Q |
10 |
gcacagattgcagtccacatt-tgagaacaattacgagaatgattggcacgtctttatttgttctgaagcggcaaagcaagtttggcaagttgctgggtt |
108 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||| |||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38196417 |
gcacagattgctgtccacattgtgagaacaattacgagaatgataggcacgtctttattggttgtgaagcggcaaagcaagtttggcaagttgctgggtt |
38196318 |
T |
|
| Q |
109 |
atgggaaactatttctgaagctgctgctacagtttcgaattttgcttaatgnnnnnnnagtttattatgcagattaccgtcacaactatgtactgatatc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38196317 |
atgggaaactatttctgaagctgctgctacagtttcgaattttgcttaatgtttttttagtttattatgcagattaccaacacaactatgtactgatatc |
38196218 |
T |
|
| Q |
209 |
gccatgatgttgtggtgtttatggcgtcggaggaatgataaggtgtgggaaggagatatgagggaagttcggttttctgttcagctagcacccgaggttc |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38196217 |
gccatgatgttgtggtgtttatggcgtcggaggaatgataaggtgtgggaaggagatatgaaggaagttcggttttctgttcagctagcacgcgaggttc |
38196118 |
T |
|
| Q |
309 |
ttttgcagtggcaggc |
324 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
38196117 |
ttttgcagtggcaggc |
38196102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 5e-19; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 272 - 324
Target Start/End: Original strand, 29122805 - 29122857
Alignment:
| Q |
272 |
gaagttcggttttctgttcagctagcacccgaggttcttttgcagtggcaggc |
324 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29122805 |
gaagttcggttttctgttcagctagcacgcgaggttcttttgcagtggcaggc |
29122857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 38 - 114
Target Start/End: Original strand, 25500289 - 25500365
Alignment:
| Q |
38 |
aattacgagaatgattggcacgtctttatttgttctgaagcggcaaagcaagtttggcaagttgctgggttatggga |
114 |
Q |
| |
|
||||| || |||||||||||||| |||||| | | ||| || ||||| ||||| |||||||| |||||| ||||||| |
|
|
| T |
25500289 |
aattatgaaaatgattggcacgtgtttattggctgtgaggctgcaaaacaagtgtggcaagtagctgggctatggga |
25500365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 203 - 269
Target Start/End: Complemental strand, 6508654 - 6508588
Alignment:
| Q |
203 |
gatatcgccatgatgttgtggtgtttatggcgtcggaggaatgataaggtgtgggaaggagatatga |
269 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||| | |||||| |||| |||| |||||| ||||||| |
|
|
| T |
6508654 |
gatatcgcgatgatgttatggtgtttatggcgtagaaggaataataaagtgtaggaaggtgatatga |
6508588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University