View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12344_low_2 (Length: 250)

Name: NF12344_low_2
Description: NF12344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12344_low_2
NF12344_low_2
[»] chr1 (1 HSPs)
chr1 (1-178)||(1112882-1113060)


Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 178
Target Start/End: Complemental strand, 1113060 - 1112882
Alignment:
1 attaaaatagcataatctctaaattcagtgatataacttaatttttacctgttctgaccaaggtcctttgataagatcaggattcaaaaccttttgccaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1113060 attaaaatagcataatctctaaattcagtgatataacttaatttttacctgttctgaccaaggtcctttgataagatcaggattcaaaaccttttgccaa 1112961  T
101 cgatgcagacattgaacatctgttctgccagtaacacatgcagctgcaagggataatgtggtcact-aataaacttaac 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||    
1112960 cgatgcagacattgaacatctgttctgccagtaacacatgcagctgcaagggattatgtggtcactaaataaacttaac 1112882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University