View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12346_high_4 (Length: 335)
Name: NF12346_high_4
Description: NF12346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12346_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 9e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 9e-98
Query Start/End: Original strand, 36 - 271
Target Start/End: Complemental strand, 2209397 - 2209150
Alignment:
| Q |
36 |
ataagagatctagaacactcagatcagaaccaaagaaaata-gtagcaaacaagtaagcaaaaatgaaagagagcaaagtgaaaggtg---aaacaatgt |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| | |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2209397 |
ataagagatctagaacactcagatcagaaccaaaaaaaaaaagtagcaaacaagtaagcaaaaatgaaagagagcaaagtgaaaggtggtgaaacaatgt |
2209298 |
T |
|
| Q |
132 |
atgtagtggtttttt--------acaaaagaagaagaccttcctcccttttataggagagcaacataggataccaaaaatttgctactatggtttttgtt |
223 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2209297 |
atgtagtggtttttttgttttttacaaaataagaagaccttccacccttttataggagagcaacataggataccaaaaatttgctactatggtttttgtt |
2209198 |
T |
|
| Q |
224 |
ttatgtggtcaatgtccagctctattgtttgcataagcatgtactcca |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2209197 |
ttatgtggtcaatgtccagctctattgtttgcataagcatgtactcca |
2209150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University