View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12347_low_16 (Length: 230)
Name: NF12347_low_16
Description: NF12347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12347_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 216
Target Start/End: Original strand, 4560193 - 4560391
Alignment:
| Q |
18 |
aattattccgttaaattcataggatgtcatgctagatgaacaagatgatgaagagacagaagttactgatgattctgtggagaattgttgcttctctttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4560193 |
aattattccgttaaattcataggatgtcatgctagatgaacaagatgatgaagagacagaagttactgatgattctgtggagaattgttgcttctctttt |
4560292 |
T |
|
| Q |
118 |
gcaatcttttgattcttttcctgcattcataatcatatgttattaatggtttttgccaacatttttcaaagagtaaaactatagttatctttacctttg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4560293 |
gcaatcttttgattcttttcctgcattcataatcatatgttattaatggtttttgccaacatttttcaaatagtaaaactatagttatctttacctttg |
4560391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 39 - 148
Target Start/End: Original strand, 5025723 - 5025835
Alignment:
| Q |
39 |
ggatgtcatgctagatgaacaagatgatgaagagacagaagttactgat---gattctgtggagaattgttgcttctcttttgcaatcttttgattcttt |
135 |
Q |
| |
|
||||| |||||||||||||||||| || ||||| | |||||| ||||| |||||||||||| ||||||| |||||| ||| || ||| ||||||| |
|
|
| T |
5025723 |
ggatgacatgctagatgaacaagacgacgaagacatggaagttcctgatgatgattctgtggaggattgttgattctctcttggaaccttcacattcttt |
5025822 |
T |
|
| Q |
136 |
tcctgcattcata |
148 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
5025823 |
gcctgcaatcata |
5025835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University