View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12349_low_4 (Length: 240)
Name: NF12349_low_4
Description: NF12349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12349_low_4 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 20 - 240
Target Start/End: Original strand, 13019392 - 13019612
Alignment:
| Q |
20 |
tgagcatcatcacaatagccttaaagcaactatacaagtagaataaacatcacaatagccttaaacattaggtagaagagttttcttacttatatgttgt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13019392 |
tgagcatcatcacaatagccttaaagcaactatacaagtagaataaacatcacaatagccttaaacattaggtagaagagttttcttacttatatgttgt |
13019491 |
T |
 |
| Q |
120 |
ttgacatcaacctctctatcatctaacgtgacactctttttgacacaaaacttattagtcaatttggttcatctagtgaagttaaatagttgatccaatn |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
13019492 |
ttgacatcaacctctctatcatctaacgtgacactcttattgacacaaaacttattagtcaatttagttcatctagtgaagttaaatagttgatgcaata |
13019591 |
T |
 |
| Q |
220 |
nnnnnngtaaatttaaattac |
240 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
13019592 |
aaaaaagtaaatttaaattac |
13019612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University