View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12350_high_5 (Length: 304)
Name: NF12350_high_5
Description: NF12350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12350_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 8 - 286
Target Start/End: Original strand, 2022624 - 2022902
Alignment:
| Q |
8 |
gaacctgtgcaaaatacccaactaaaagtaatttgagcacacatgctcatacatatacatgattcaatcttagagtattagattaatcaattcagggaga |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
2022624 |
gaacttgtgcaaaatacccaactaaaagtaatttgagcacacatgctcatacatatgcatgattcaatcttatagtataagattaatcaattcagggaga |
2022723 |
T |
 |
| Q |
108 |
gcttctgaatttatggtactactgatcactattatttaagttgtaccgagtccaagatttaaaaatgacatgaaatgagggagagtcttttctttaactc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2022724 |
gcttctgaatttatggtactactgatcactattatttaagttgtaccgagtccaagatttaaaaatgacatgaaatgagggagattcttttctttaactc |
2022823 |
T |
 |
| Q |
208 |
tagactaaaactttgtccgggcaaagaatttgtccaagaccttttacaatttaaaaagtattatttgggtgagtcattg |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2022824 |
tagactaaaactttgtccgggcaaagaatttgtccaagaccttttacaatttaaaaagtattatttgggtgagtcattg |
2022902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University